... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section ... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... pruning may be regarded asthe special case of our statistical model, since the maximum-matching algorithm of baseNP rules is only a simplified processing version of our statistical model Compared...
... wave breaking on a natural beach To verify the accuracy ofthe numerical model on the simulation ofthe wave transformation on a natural beach, existing experimental data on the wave dynamics in ... wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ... suitable fora practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated that in the surf zone, the time scale ...
... size ofthe temporary cavity and the infiltration depth ofthe barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case ofthe full metal jacket ... depth of barium titanate particles in the temporary cavity The radiological examination ofthe infiltration depth of barium titanate particles within the ruptures ofa temporary cavity in the gelatin ... the gelatin block was evaluated After the centre ofthe gelatin block had been determined, the mean diameter ofthe permanent cavity was identified To this end, the length ofthe permanent cavity...
... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 asa relevant biomarker for apoptosis In an ideal setup these data would have been ... expression of caspase-3 was analyzed by flow cytometry In a limited number of experiments, analyses of specific mRNA of caspase-3 were also performed by reverse transcriptase – polymerase chain reaction ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized...
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
... performance database was designed to store the majority ofthe data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... based and will consists of two major tasks Firstly, the collection of necessary data and information was done Most ofthe data was obtained from the seasonal monitoring program under the Strategic ... of base/subbase, and resilient modulus ofthe subgrade Among these material properties, those associated with asphalt concrete and subgrades are known to fluctuate seasonally Therefore seasonal...
... lessons They also use ready-made tasks if they are suitable to their sts as they said that sometimes they not have time to modify the tasks All of them confirm that they have never assigned the recordings ... CHAPTER 5: CONCLUSION Authentic language can reflect a naturalness of form and an appropriateness of cultural and situational contexts Since authentic texts are generated by and for native speakers ... selecting information tend to be easier than tasks which require separating fact from opinion • Tasks that require information relevant to the main theme tend to be easier than tasks which ask for irrelevant...
... MD, Malfait AM, Arner E: The role of ADAM-TS4 (aggrecanase-1) and ADAM-TS5 (aggrecanase-2) in amodelof cartilage degradation Osteoarthritis Cartilage 2001, 9:539-552 Samad TA, Moore KA, Sapirstein ... injectable saline asthe vehicle After appropriate anesthesia each rat was positioned on its back and the left leg was flexed 90 degrees at the knee The patellar ligament was palpated below the patella ... animals were disarticulated and the tibial plateau imaged using an Optimas image analyzer The tibial plateau was used for image analysis because it provided a relatively flat surface compared...
... 160’ and 180’ through the contralateral arm vein Each sample was immediately centrifuged and plasma was separated Plasma glucose was measured by the glucose oxidase method (Beckman Glucose Analyzer ... ranges The facts that this behaviour is the same both forthe HOMA and forthe newer and more accurate HOMA2, and that the large variability of SI index values would in any case produce lack of ... comparisons and assess coherence among themodel derived indices, asthe EHC-derived M was not available for most ofthe evaluated subjects The HOMA insulin resistance index was computed as the...
... entirely applicable to asthma induced by these allergens Therefore, there is a need for an asthma model based on real aeroallergens There is a lack of tools to study T cells in allergic asthma inflammation ... be found in the upper layers ofthe epithelium and lamina propria ofthe airways These DCs are at an immature state Therefore, at steady state, uptake and presentation of antigen by these DCs would ... secretion as well as mediate the recruitment of other immune cells to the site (40, 51) The proteases in the mast cell granules such as tryptase and chymase may also affect the bronchial epithelium and...
... described asthe ideology of chiropractic or the hypothesis of chiropractic, rather than asa philosophy This modelof chiropractic has continued to advance a hypothetical modelof health and disease ... "primary care," and "portal of entry," and that this confusion is at least partially responsible forthe enthusiasm forthe primary care modelThe American Chiropractic Association, in fact, ... • Chiropractic as conservative/minimalist healthcare provider • Chiropractic asa fully integrated part ofthe healthcare system, rather than as an alternative and competing healthcare system...
... (micromolar) affinity Asthe bioassays on state, whereas [A1 0L]PnIA stabilizes a desensitized state fish and insects as well as intracranial injections into rats which, in the case ofthe a7 [L247] mutant, ... release in the rat striatum (A) Nicotine acts at somatodendritic nAChR in the substantia nigra pars compacta and at presynaptic nAChR in the striatum (B) a- Conotoxin MII was one ofthe first antagonists ... subunits, an a6 /a3 chimera consisting ofthe extracellular ligand-binding domain ofthe a6 subunit and the transmembrane and intracellular domains ofthe a3 subunit was used in this study PIA selectively...
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... down-regulated by decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case forthe native role of APP ⁄ Ab ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors...
... Recapitalization Planning: Toward a Fleet Management Modelforthe HMMWV Table 4.1 Fleet Management Model Assumptions in Sensitivity Analyses and Base Case Replace Earlier Base Case Replace Later ... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... “replace-later” case Table 4.1 summarizes our base-case and sensitivity-analysis assumptions Themodel inputs and our assumptions for each ofthe three cases are discussed in the sections below As...
... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA ... text for details), although it was not detected by the immunological assays Psb P Cyanobacteria Glaucophyceae Red algae Diatoms Haptophyceae Brown algae Prasinophyceae Euglenophyceae Green algae...
... Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... and off rate At a xed k2, a change in this ratio may be interpreted asa change in the afnity ofthe enzyme forthe substrate Hence, we can assess relationships of this afnity parameter and the ... approximations asthe average area of randomly adsorbed enzymes will be larger than the footprint, and only a certain fraction ofthe enzyme will be adsorbed in the initial stages Nevertheless, the analysis...
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... by an antigen vaccination strategy This has proven efficient in the NOD mouse model, as well as in other murine models of T1D [95-100] The feasibility of translating these therapies to humans ... responsible fora differential glycosylation pattern [24] As such, the presence ofa proline rather than a serine at position ofthe mature IL-2 protein, is associated with an increased glycosylation and...